circad | circRNAs associated with diseases

hsa_circ_0028882
Gene	DYNLL1	Organism	Human
Genome Locus	chr12:120907659-120936298:+	Build	hg19
Disease	Postmenopausal Osteoporosis	ICD-10	Endometriosis of uterus (M81.0)
DBLink	Link to database	PMID	29742503
Experimental Method
Sample Type	Peripheral Blood Mononuclear Cells (PBMCs)	Comparison	58 menopausal patients with 41 control menopausal women
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ACTTCTGCCCACGTTGTTTTC Reverse AGGCTGCAGTCCTTGTTTTTG	Statistics	Fold Change : Upregulated,6.2583507 pvalue : p=0.038050619
Citation
Zhao, K, Zhao, Q, Guo, Z, Chen, Z, Hu, Y, Su, J, Chen, L, He, Z, Cai, X, Chen, M, Zheng, L, Wang, W, Wang, Q (2018). Hsa_Circ_0001275: A Potential Novel Diagnostic Biomarker for Postmenopausal Osteoporosis. Cell. Physiol. Biochem., 46, 6:2508-2516.